The DNA

Version française : Steemit | Busy

The common point that we can find for every living organisms on Earth (and maybe somewhere else, the future will tell us that) is well DNA. We all know DNA, we already heard that in CSI or science fictions movies but… first what mean DNA? Deoxyribonucleic acid!
If you say.png Does matter the name.
First of all, let’s explain his function. We can summarize his role by “transmission of information tool”, yes it allows saving information from father organism to child organism in a code.

A code? Like a computer so!

Yes, let’s take this analogy! The base of our numeric information is coded with 0 and 1 (with several different languages using this code). With only 2 variable we have developed so many incredible things (video game, internet, the blockchain, …). Nowadays, we even talk about quantic computer which gives several values to 0 and 1 (but I will not go further on this subject, it’s not my field).

Genetic information is coded in DNA with four variables (called base): A, C, T, and G. Every living organisms have a genetic sequence which defines them fully (from machinery to eyes colour). Like this:
TACTTCCTACCGGCTGACGGAACACTTCCACTACTGGACCAAGCATAACCGCGTGAATTCCGCGCTTCAGCCGGAATTCTTCGTCGAGATCTCCGAGGAACTGGCAGAGGAGAAGAATATAGAAAACGGCGGCTGGGTCCGGGTGTGGTCGAAGCGTGGTTCGGTCAAGGCGAAGGCGGTGGTGACCAAGCGCATCCGGCCGCTGATGTGCGACGGCAAGCCGGTCCATGTGGTGGGCATCCCGCTTCACTGGGGGTTCACCGGCTCGGCGAAAAAGGGC

But me, when we say me DNA I see this:

ADN

Source: https://commons.wikimedia.org/wiki/File:DNA_structure_and_bases_FR.svg

Indeed, it’s DNA shape (double helix), like a twisted ladder. Don’t forget that is very old technology (3.8 billion of years), it had got time to increase itself during this time. Therefore, it’s a bit complex thing:
Real talk.png
Explication: each ladder bar that you see is a base pair, so two attached bases. Bonds between bases is always between the same friends: A-T and C-G (you never see a C-A or G-A). However just one ladder side is the sequence containing the code, the other side is a protection.

So, what is the code length?

It depends on the organism! Let’s see few example:

Bp=Base pair

Questionnement lourd.png
You said me that all of this is in one cell? Well yes, genetic sequence curling on itself as smallest as possible to be inside the cell like a big coil.

But which cell wear this “big coil of DNA”? All cells wear this big coil of DNA, and the genetic sequence is the same between all the cells. But I reassure you this sequence is changing between two individual (except if they are twins or clones).

Why do we call it a genetic sequence?

That is from the word gene, well, let’s summarize this for one individual:

All the genetic information of one individual is called the genome, this genome is generally cut into big pieces called chromosomes moving in the cell. If we unroll one of the chromosomes we obtain the genetic sequence GGCGGCTGGGTCCGGGTGTGGTCGAAGCGTGGTT which is composed of genes. Genes are a part of the sequence, they are used for one (or more) function(s), we can call it coding region. So, genetic sequence is an alternation of coding and non-coding regions. Genes size is variable but is about 2, 000bp.

So, big genome = Big numbers of genes?

Finally, not quite, let's resume the table above:

Maize (Zea mays) has more genes than poplar (Populus trichocarpa), but it is not proportional to their genome size which is 10 times bigger.

This, is about DNA, this technology has more than one string to his bow, and you aren’t after your surprise. But let’s let this for the moment, in the next chronicle we will deal with how, from a bacterium, we have now trees, birds, Justin Bieber, …